Tachinid Recording Scheme

... it's a bristle thing

Actia Robineau-Desvoidy, 1830

Primary tabs

EOL Text

Statistics of barcoding coverage: Actia Janzen11:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 24
Species With Barcodes: 1

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=311676

Barcode data: Actia Janzen12:

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=311680

Statistics of barcoding coverage: Actia Janzen18:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=311700

Barcode data: Actia Janzen06:

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=311688

Statistics of barcoding coverage: Actia sp. B:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=499456

Statistics of barcoding coverage: Actia Janzen12:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=311680

Barcode data: Actia Janzen05:

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AACCTTGTATTTCATTTTTGGTGCCTGATCAGGAATATTAGGAACTTCATTAAGATTATTAATTCGAGCAGAATTAGGTCACCCAGGAGCATTAATTGGAGATGATCAAATTTATAATGTAATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGTGGATTTGGAAACTGACTAGTTCCTTTAATATTAGGAGCTCCCGATATAGCCTTTCCTCGAATAAACAATATAAGTTTTTGATTACTACCTCCAGCACTAACCTTACTTTTAATAAGAAGAATAGTCGAAAGCGGGGCTGGAACAGGATGAACAGTTTACCCCCCCTTATCCTCTAATATCGCTCATAGAGGAGCTTCTGTTGACTTAGCCATTTTTTCTTTACATCTAGCAGGAATTTCTTCCATTTTAGGTGCGGTTAATTTCATTACAACAGTAATTAATATACGATCATCAGGAATTTCATTTGATCGTATACCTTTATTTGTTTGATCTGTAGTAATTACAGCTTTTCTATTATTATTATCCTTACCCGTATTAGCAGGAGCTATTACAATACTATTAACAGACCGAAATTTTAACACTTCATTTTTTGACCCCGCAAGCGGGGGAGACCCAATTTTATACCAACATTTATTT
-- end --


Download FASTA File

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=311699

Statistics of barcoding coverage: Actia Janzen06:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 9
Species With Barcodes: 1

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=311688

Statistics of barcoding coverage: Actia Janzen29:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=510086

Barcode data: Actia Janzen10:

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGTGCATGATCTGGAATAGTAGGAACTTCATTAAGTTTATTAATTCGAGCAGAATTAGGACATCCAGGAGCCCTAATTGGAGATGATCAAATTTATAATGTTATTGTAACAGCCCATGCTTTTATTATAATTTTTTTTATAGTAATACCGATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATACTAGGAGCCCCAGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGACTATTACCCCCAGCATTAACTTTACTTTTAATAAGAAGAATAGTAGAAAGTGGAGCTGGAACAGGATGAACAGTTTATCCTCCATTATCAGCTAATATTGCTCACAGAGGAGCTTCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGTATTTCATCCATTTTAGGAGCTGTTAATTTTATTACTACCGTTATTAATATACGTTCAGTTGGAATTTCTTTTGATCGAATACCCTTATTTGTTTGATCTGTAGTAATTACTGCTTTTCTTTTATTATTATCATTACCAGTATTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTTAATACTTCATTTTTTGATCCTGCAAGAGGAGGAGACCCAATTCTTTATCAACATTTATTT
-- end --


Download FASTA File

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=311679
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith