Tachinid Recording Scheme

... it's a bristle thing

Linnaemya Robineau-Desvoidy, 1830

Primary tabs

EOL Text

Statistics of barcoding coverage:

Barcode of Life Data Systems (BOLD) Stats
Specimen Records:155
Specimens with Sequences:148
Specimens with Barcodes:140
Species:21
Species With Barcodes:19
Public Records:69
Public Species:5
Public BINs:6

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=78384

Statistics of barcoding coverage: Linnaemya sp. 2:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=474900

Statistics of barcoding coverage: Linnaemya sp. 1:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=474899

Barcode data: Linnaemya Wood01DHJ03:

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TACTTTATATTTTATTTTAGGAGCTTGATCCGGAATAATTGGAACTTCTTTAAGAATTTTAATTCGAACAGAATTAGGTCATCCTGGAGCATTAATTGGAGATGATCAAATTTATAATGTAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGGGCCCCAGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGACTTTTACCTCCTGCATTAACTTTATTATTAGTAAGTAGTATAGTGGAAAATGGAGCTGGTACAGGATGAACTGTTTATCCACCTTTGTCATCTAATATTGCTCATGGTGGAGCCTCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCATCAATTTTAGGGGCCGTAAATTTTATTACAACAGTAATTAATATACGATCAGCCGGAATTACTTTTGACCGAATACCTTTATTTGTCTGATCTGTAGCAATTACAGCTTTATTACTTTTATTATCCTTACCAGTTTTAGCTGGAGCCATTACAATATTATTAACAGATCGAAATTTAAATACTTCATTTTTTGACCCTGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT
-- end --


Download FASTA File

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=251703

Statistics of barcoding coverage: Linnaemya Wood01DHJ03:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=251703

Barcode data: Linnaemya Wood01DHJ01:

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=123471

Statistics of barcoding coverage: Linnaemya Wood01DHJ01:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=123471

Barcode data: Linnaemya Wood01DHJ02:

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=123465

Statistics of barcoding coverage: Linnaemya Wood01DHJ02:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=123465

Locations of barcode samples:

Collection Sites: world map showing specimen collection locations for Linnaemya

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=78384
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith